Prostate cancer is the second leading cause of cancer deaths among men in Western counties and has increased in incidence also in China in recent years

Prostate cancer is the second leading cause of cancer deaths among men in Western counties and has increased in incidence also in China in recent years. tumor tissues, was downregulated in DU145 and LNCap cells. siRNA-mediated silencing of MTDH in prostate cancer cells decreased their proliferation and invasive capabilities, suggesting that SU6668 may inhibit cell proliferation and invasion BIX02189 of prostate cancer cells partly through downstream targeting of MTDH. Mechanistic investigations showed that AKT signaling pathway was inhibited after SU6668 treatment in prostate cancer cells. Moreover, a combination of SU6668 and PI3K-AKT pathway inhibitor LY29004 resulted in increased inhibition of cell proliferation and invasion in DU145 cells. Taken together, our findings revealed that SU6668 suppressed prostate cancer progression by downregulating MTDH/AKT signaling pathway and identified a promising therapeutic strategy for prostate cancer. (9) demonstrated that SU6668 is not a potent inhibitor of human cancer cells grown in culture. In contrast, Wang (11) in 2013 found that SU6668 directly suppresses the proliferation of triple-negative breast cancer cells. These conflicting findings suggest that the role of SU6668 in human cancer cells needs to be further studied. Moreover, the effect and potential molecular mechanism of SU6668 in prostate cancer have not been analyzed in detail and thus still require clarification (12C15). Metadherin (MTDH), also known as astrocyte elevated gene-1 (AEG-1), was first identified in primary human fetal astrocytes exposed to HIV-1 in 2002 (16C18). MTDH can be overexpressed in lots of tumor cells and is known as a BIX02189 book oncogene (19C21). Aberrant manifestation of MTDH can be correlated with cell proliferation, migration, invasion, angiogenesis and apoptosis in an array of solid malignancies, including breast cancers, glioblastoma, gastric and prostate tumor (22C26). In the present study, we found that SU6668 inhibited proliferation, invasion and epithelial-mesenchymal transition (EMT) of prostate cancer cells. After SU6668 treatment, MTDH protein, which has been reported to be significantly overexpressed in many human tumor tissues, was downregulated in DU145 and LNCap cells. Mechanistic investigations identified that this AKT signaling pathway was inhibited after SU6668 treatment in prostate cancer cells. Taken together, our findings revealed that SU6668 suppressed prostate cancer progression by downregulating the MTDH/AKT signaling pathway. Materials and methods BIX02189 Cell cultures The human prostate cancer cell lines DU145, LNCap and PC3 were maintained in RPMI-1640 (Gibco/Invitrogen, Sao Paulo, Brazil) supplemented BIX02189 with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. All cell lines used in the present study were cultured in a humidified environment made up of 5% CO2 and held at a constant temperature of 37C. Real-time PCR Total RNA was extracted using TRIzol reagent (Invitrogen) and reverse transcribed using the transcriptase cDNA synthesis kit (Promega, Fitchburg, WI, USA) according to the manufacturer’s instructions. Real-time PCR analysis was performed using SYBR Premix Ex Taq? (cat. no. RR420A; Takara, Dalian, China) in an Applied Biosystems 7500 Real-Time PCR system according to the manufacturer’s instructions. Primers (F, AAGCAGTGCAAAACAGTTCACG and R, GCACCTTATCACGTTTACGCT) for MTDH mRNA expression detecting was synthetized by Sangon Biotech, Co., Ltd. (Shanghai, China). Cell Counting kit-8 Cells were seeded in 96-well plates and the proliferation of the cells was assayed at 0, 24, 36 and 48 h using Cell Counting kit-8 (CCK-8; Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer’s instructions. Cell viability was assessed by the measurement of absorbance at 450 nm using a microplate reader. Western blot analysis Cells were treated in 6-well plates, washed three times by phosphate-buffered saline (PBS) and lysed for 10 min on ice in radioimmunoprecipitation assay (RIPA) buffer made up of an anti-protease mixture. Protein concentration was measured by bicinchoninic acid assay (BCA). The protein fractions were resuspended in launching buffer and denatured at 100C for 10 min. Total protein (20 (38) reported that modifications within BIX02189 the PI3K-AKT-mTOR pathway had been within 42% of major prostate tumors and 100% of metastatic tumors. The PI3K-AKT pathway is certainly a significant signaling JTK12 pathway controlled by MTDH and creates MTDH-induced modifications in tumor cell proliferation and invasion (40). In looking into the molecular systems of MTDH-mediated invasion and proliferation of prostate tumor cells, we first noticed that downregulated appearance of MTDH resulted in a reduction in p-AKT level (Figs. 7 and ?and8).8). Furthermore, a combined mix of SU6668 as well as the AKT pathway inhibitor LY29004 led to elevated inhibition of cell proliferation and invasion in DU145 and LNCap.