The present study assessed the cytotoxicity of sodium meta-arsenite (SMA) on telomere shortening and cellular apoptosis in human being A-549, MDA-MB-231 and U87-MG cancer cell lines

The present study assessed the cytotoxicity of sodium meta-arsenite (SMA) on telomere shortening and cellular apoptosis in human being A-549, MDA-MB-231 and U87-MG cancer cell lines. For detecting telomerase activity, the conventional PCR-based assay protocol was revised into the relative-quantitative telomeric repeat amplification protocol (RQ-TRAP) using Rotor Gene Q (Qiagen, USA), real-time PCR machine, as previously explained by Jeon et al. (2011b). Briefly, the control and SMA-treated cells were harvested at 1??105 cells per sample. Each of the samples was lysed with 400?l of 0.5% (v/v) 13-[(3-cholamidopropyl) dimethylam-monio] propanesulfonic acid (CHAPS) lysis buffer (pH 7.5) supplemented with 10?mM Tris-HCl, 1?mM MgCl2, 1?mM EGTA, 0.1?mM benzamidine, 5?mM -mercaptoethanol and 10% glycerol for 30 min at 4C, and subsequently hucep-6 centrifuged for 20?min at 12,000at 4C. An 80% volume of supernatant from each of the lysed samples was transferred to a fresh fresh sample tube and the concentration of total protein was measured using a spectrophotometer (Mecasys, Korea). The response mix for RQ-TRAP was made up of Rotor-Gene? 2 SYBR Green (Qiagen, USA), 5?g total protein of every from the lysed test, 2.5?mM MgCl2, 0.02?g of telomerase TS primer and 0.04?g of anchored come back ACX primer that are shown in Desk 1. The ultimate level of the response mixtures was altered into 20?l with RNase-free drinking water. The reaction mixtures were processed for 30?min incubation in 30C and 10?min in 94C to denature each one of the examples. And every one of the examples were amplified in 40 PCR cycles comprising 94C for 30 subsequently?s, 60C for 90?s and 72C for 0?s. The comparative quantification of all examples was computed with the next derivative approach to crossing stage (Cp) perseverance using Gene Q Series Software program (Qiagen, USA). The comparative degree of telomerase activity in neglected control and 1?M SMA-treated sample was calculated, based on the level of telomerase activity considered as 100% in untreated MRC-5 fibroblasts, and at least five replicates of RQ-TRAP were carried out in each sample. Table 1. Primer sequences, PCR product size and annealing heat used for RQ-TRAP and RT-PCR. thead valign=”bottom” th align=”remaining” rowspan=”1″ colspan=”1″ Gene /th th align=”center” rowspan=”1″ colspan=”1″ Primer sequences (5C3) /th th align=”center” rowspan=”1″ colspan=”1″ Amplification size (bp) /th th align=”center” rowspan=”1″ colspan=”1″ Annealing temp (C) /th /thead RQ-TRAP br / TSAATCCGTCGGAGCAGAGTT?60RQ-TRAP br / Schizandrin A ACXGCGCGGCTTACCCTTACCCTTACCCTAACC?60GAPDHGAAGGTGAAGGTCGGAGTC br / GAAGATGGTGATGGGATTTC22857TERTCGGAAGAGTGTCTGGAGCAA GGATGAAGCGGAGTCTGGA;19860TERCTCTAACCCTAACTGAGAAGGGCGTAG, br / GTTTGCTCTAGAATGAACGGTGGAAG12660BAXTCTGACGGCAACTTCAACTG br / AGTCCAATGTCCAGCCCATG12760Caspase-3TGAGCCATGGTGAAGAAGGA br / TCGGCCTCCACTGGTATTTT22055Caspase-9CTCTTGAGAGTTTGAGGGGAAA br / ACTCACGGCAGAAGTTCACA10555p21TGGCAGTAGAGGCTATGGA br / AACAGTCCAGGCCAGTATG17857HSP70ACGAATCCCTGCGGTAAAAG br / AAAGCAGCGATAAGATGGC12760HSP90ACAAGCACATATGGCTGGAC br / TCTTTGCTGCCATGTAACCC9458 Open in a separate window Analysis of telomere length by chemiluminescent assay After in vitro cell tradition for up to 2 weeks in total A-DMEM media containing 0 (untreated control) and 1?M SMA, the telomere length of malignancy cells from different Schizandrin A cell lines was analyzed by non-radioactive chemiluminescent assay protocol with TeloTAGGG telomere restriction fragment Schizandrin A size assay kit (Roche, USA), according to the manufacturers instructions. Briefly, the genomic DNA in the untreated control and SMA-treated cells was extracted with total DNA purification kit (GeneAll, Korea). Following measurement of the extracted DNA concentration having a spectrophotometer (Mecasys, Korea), 1?g of total DNA was digested in the buffer containing a mixture of Hinf I and Rsa I restriction enzymes for 2?h at 37C. The DNA fragments were run in 0.8% agarose gel, subsequently treated with HCl, denaturation buffer and neutralization buffer. The treated gel was transferred onto a positively charged nylon membrane (Roche, USA). The membrane was treated having a digoxigenin (DIG)-labeled telomere hybridization probe (Roche, USA) at 42C for 3?h, washed with high stringency buffer and then treated with anti-DIG-alkaline-phosphatase buffer for 30?min. After becoming rinsed with washing buffer, the membrane was exposed to X-ray film for 20C30?min at 25C. The images of the telomeric repeats within the X-ray film were acquired by an image scanning system. The length of telomeric repeats was identified at a spot with the Schizandrin A highest intensity using Gelviewer image-processing software (Innogene, Korea). Analysis of senescence-associated -galactosidase activity The cellular frequency of the cells with activity of senescence-associated -galactosidase was investigated in the 0 (untreated control) and 1?M SMA-treated cells using cell senescence assay kit (Cell Signaling Technology, USA), according to the manufacturers protocols. Briefly, each type of malignancy cells were seeded at 0.5??104 cells/well into a 6-well plate, and cultured in complete A-DMEM media containing 0 and 1?M SMA for up to 2 weeks. After being washed with D-PBS, the cells were treated in 1?ml of fixative answer contained in the package for 10C15?min in room temperature. The cells were then incubated with 1 subsequently?ml of senescence-associated -galactosidase.